|
Servicebio Inc
universal reverse pcr primer Universal Reverse Pcr Primer, supplied by Servicebio Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/universal reverse pcr primer/product/Servicebio Inc Average 86 stars, based on 1 article reviews
universal reverse pcr primer - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
tiangen biotech co
reverse primer Reverse Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer/product/tiangen biotech co Average 99 stars, based on 1 article reviews
reverse primer - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
tiangen biotech co
primer Primer, supplied by tiangen biotech co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer/product/tiangen biotech co Average 99 stars, based on 1 article reviews
primer - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
primer chatcre common reverse cag ggt tag tag ggg gtc ac Primer Chatcre Common Reverse Cag Ggt Tag Tag Ggg Gtc Ac, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer chatcre common reverse cag ggt tag tag ggg gtc ac/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
primer chatcre common reverse cag ggt tag tag ggg gtc ac - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac Epcam Primers Forward Ttgccgcagctcaggaagaatg Reverse Gcagccagctttgagcaaatgac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac/product/Sangon Biotech Average 86 stars, based on 1 article reviews
epcam primers forward ttgccgcagctcaggaagaatg reverse gcagccagctttgagcaaatgac - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Jackson Laboratory
primer smo l l mutant reverse ctc cag act gcc ttg gga aaa Primer Smo L L Mutant Reverse Ctc Cag Act Gcc Ttg Gga Aaa, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer smo l l mutant reverse ctc cag act gcc ttg gga aaa/product/Jackson Laboratory Average 86 stars, based on 1 article reviews
primer smo l l mutant reverse ctc cag act gcc ttg gga aaa - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Azenta
reverse primers Reverse Primers, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primers/product/Azenta Average 86 stars, based on 1 article reviews
reverse primers - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag Dyrk1b Primers Forward Cgcaggaggtcgtacaggtgg Reverse Accagcatgacacggagatgaag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag/product/Sangon Biotech Average 86 stars, based on 1 article reviews
dyrk1b primers forward cgcaggaggtcgtacaggtgg reverse accagcatgacacggagatgaag - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag Wdr77 Primers Forward Cacttgtgttgctgcctctcctc Reverse Aagccagcgaggtaggaaggtag, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag/product/Sangon Biotech Average 86 stars, based on 1 article reviews
wdr77 primers forward cacttgtgttgctgcctctcctc reverse aagccagcgaggtaggaaggtag - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg Tiparp Primers Forward Tgtttg Gccgtgacaggata Reverse Gcatgctttccacagcatcg, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg/product/Sangon Biotech Average 86 stars, based on 1 article reviews
tiparp primers forward tgtttg gccgtgacaggata reverse gcatgctttccacagcatcg - by Bioz Stars,
2026-05
86/100 stars
|
Buy from Supplier |